Tulip virus X (TVX) associated with lemon balm (Melissa officinalis) variegation: First report of TVX in the United States
*martinrr@science.oregonstate.edu
1 Dept. of Botany and Plant Pathology & Center for Gene Research and Biotechnology, Oregon State University, Corvallis, 97331
2 USDA-ARS, Horticultural Crops Research Laboratory, Corvallis, OR 97330
Accepted: 14 Jan 2005
Lemon balm (Melissa officinalis) has been grown for centuries as an ornamental and for its medicinal properties. One of the most popular clones shows bright variegation symptoms (Fig.1). Mechanical inoculations onto Gomphrena globosa using variegated leaf tissue as the inoculum source, resulted in development of necrotic lesions about five days post inoculation, which suggested a viral etiology of the variegation. Negatively-stained leaf dips, examined with an electron microscope, revealed particles of approximately 500 x 13-14 nm in size.
Double-stranded RNA was extracted from a variegated clone of the M. officinalis and cloned as described elsewhere (Tzanetakis et al., In Press). Sequence data (Genbank accession No. AY842508-AY842510) revealed that the plant was infected with Tulip virus X (TVX). Oligonucleotide primers TVX 1F (5'GACAYTCTAACCCCTTCGC 3'), TVX 1R (5'GCCCTCTGTGGAAGTATCT 3') and TVX 2F (5' GAACAAGCACACCTCCACCA 3'), TVX 2R (5' AGTGTGG TTTTCCCGGC 3') were developed for detection of the virus and were used in reverse transcription-polymerase chain reaction (RT-PCR) to test for TVX in four variegated clones of M. officinalis from Oregon and Washington, as well as G. globosa indicators with symptoms. The above mentioned plants all tested positive for TVX by RT-PCR, while non-inoculated G. globosa or M. officinalis plants without symptoms were negative. The amplicons were sequenced which confirmed their identity as TVX. This is the first report of TVX in association with the variegation in lemon balm and the first report to our knowledge for the presence of the virus in the United States.


References
- Tzanetakis IE, Keller KE, Martin RR. The use of reverse transcriptase for efficient first- and second-strand cDNA synthesis from single- and double-stranded RNA templates. Journal of Virological Methods. In Press
This report was formally published in Plant Pathology
©2005 The Authors