New Disease Reports
New Disease Reports (2005) 12, 8.
Next > < Prev

Potato deforming mosaic disease is caused by an isolate of Tomato yellow vein streak virus

S.G. Ribeiro 1*, A.K. Inoue-Nagata 2, J. Daniels 3 and A.C. de Ávila 2

*simone@cenargen.embrapa.br

Show affiliations

Accepted: 09 Aug 2005

The disease known as potato deforming mosaic was first reported in the 1980's in Southern Brazil (Daniels & Castro, 1985). Symptoms of mosaic with leaf distortion (Fig. 1) were seen in infected potato plants and a virus was suggested as the causal pathogen. In this study, we have characterised the causal agent of this disease by transmission experiments and molecular analysis of the viral genome.

The original virus isolate was collected from a potato plant in 1983 in the State of Rio Grande do Sul and maintained through vegetative propagation in the greenhouse. The virus was easily transmitted from potato by the whitefly Bemisia tabaci biotype B causing mottling, chlorotic spots and leaf distortion on tomato, vein banding and mosaic on Nicotiana benthamiana and vein clearing on Nicandra physaloides. These properties are consistent with the disease agent being a geminivirus.

PCR amplification using primers CP2 (5'cccctgcagaacttccaagtctggacg3') and PAL1v1978 (Rojas et al., 1993) produced a DNA A derived fragment of 1.8 Kb encoding the entire coat protein gene, common region and part of the AC1 gene. Sequence comparison showed highest identity (97.3%) to Tomato yellow vein streak virus (ToYVSV-U79998), a virus previously described in tomatoes in Brazil (Faria et al., 1997). The presence of a B component was confirmed by PCR with primers B1200F (5'CCCCTGCAGTAYTAYTGYTGGATGTC3') and B1900R (5'cccctgca grtgyaacatwgatctcc3'); with amplification of a fragment of approximately 800nt comprising 3' end of the BV1 gene, the small intergenic region and the 5' half of the BC1 gene.

Our results indicate that the potato deforming mosaic and tomato yellow vein streak diseases are caused by the same geminivirus, belonging to the Begomovirus genus. The potato deforming mosaic disease was described more than 20 years ago but was of little economical relevance (Daniels & Castro, 1985). Since then this virus, now named ToYVSV, has re-emerged and is currently the major begomovirus affecting tomatoes and potatoes in the state of São Paulo (Souza-Dias et al., 2003).

This is the first record of natural infection of ToVSV in potato.

Figure1+
Figure 1: Symptoms of mosaic and leaf distortion with yellow blotches in infected potato plant
Figure 1: Symptoms of mosaic and leaf distortion with yellow blotches in infected potato plant

Acknowledgements

We wish to thank Dr Marcel Prins for his comments.

References

  1. Daniels, J, Castro LAS, 1985. Ocorrência do vírus do mosaico deformante da batata no Rio Grande do Sul. Fitopatologia Brasileira 10, 306.
  2. Faria JC, Souza-Dias JAC, Slack S, Maxwell DP, 1997. A new geminivirus associated with tomato in the State of São Paulo, Brazil. Plant Disease 81, 423.
  3. Rojas MR, Gilbertson RL, Russell DR, Maxwell DP, 1993. Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant Disease 77, 340-347.
  4. Souza-Dias JAC, Sawasaki HE, Santini A, 2003. Plantio sucessivo de batata e tomate na região de Sumaré, SP favorece a presença do Tomato yellow vein streak geminivirus (ToYVSV) e da mosca branca vetora. Fitopatologia Brasileira 28, 372.
This report was formally published in Plant Pathology

©2005 The Authors