Moroccan watermelon mosaic virus newly reported on zucchini squash in France

During the autumn of 2002, zucchini squash (Cucurbita pepo) plants showing severe mosaic and blisters on leaves, as well as fruit deformations, were observed near Agen (South-Western France). DAS-ELISA tests gave positive reactions for Moroccan watermelon mosaic virus (MWMV; genus Potyvirus), a virus not yet reported in France. Sample SO-06 was positive for MWMV but also for Cucurbit aphid borne yellows virus (CABYV; genus Polerovirus) and Watermelon mosaic virus (WMV; genus Potyvirus). MWMV was separated by non-persistent transmission using single Myzus persicae per test plant. A pure MWMV subculture was thus obtained (MWMV-Fr) and used for mechanical inoculation to differential hosts. Severe mosaic and leaf deformations were observed in zucchini squash, watermelon and cucumber, while top necrosis was observed in melon cv Védrantais. In non-cucurbit hosts, symptomless systemic infections were detected in Ranunculus sardous and Lavatera trimestris, while only local lesions were observed in Chenopodium amaranticolor.

To confirm the identification of MWMV, total RNA was extracted from infected plants using Tri-Reagent (Molecular Research Center, Cincinnati, OH) and tested using Takara One-Step RNA PCR kit with specific primers MWMV-5': AGCAAGCGCCATACTCTGA and MWMV-3': CAAACTCCATTAACATTCGG, designed to amplify a region of the polymerase (NIb) and coat protein (CP). RT-PCR products of the expected size of 627 bp were generated from infected plant extracts. No amplicon was produced from healthy plant extracts.

An RT-PCR product amplified from isolate MWMV-Fr was directly sequenced (GenBank EF579942). This nucleotide sequence showed 97% identity to the corresponding region of the MWMV type strain from Morocco (GenBank AF305545; Lecoq et al., 2001). MWMV has been reported in Africa, Spain (Lecoq et al., 2001) and more recently in Italy (Roggero et al., 1998). MWMV could be an emerging threat for southern Europe. However, MWMV has not been detected again during intensive surveys conducted in southern France since 2004. This suggests that MWMV has not become established in France.