First Report of Carnation mottle virus in Turkey

Carnation (Dianthus caryophyllus) is the most important cut flower produced in Turkey. However, yield and quality are lower than carnations from Turkey’s international competitors (Taşcıoglu & Sayın, 2005). This could be due to virus infections causing reduction of yield, size and the quality of the flowers. Detection of Carnation mottle virus (CarMV) in other countries (Sanchez-Navarro et al., 1999; Singh et al., 2005) and the presence of suspect plants in Antalya prompted screening for CarMV. Surveys were conducted in the greenhouses of three different carnation producers in Antalya and 17 samples representing 17 different cultivars were collected. Total RNA was isolated from 100 mg leaf samples from plants using a one-step RNA isolation method (BioBasic, MarkhamOntario, Canada). A set of primers specific to the conserved sequences of CarMV coat protein (CP) gene was designed (sense BC57 5’ GATCGCGATGAATCCCA CTGTGC 3’ and anti-sense BC58 5’ TCACATCCTATAAACAACCATTG 3’) using sequences available in GenBank. Samples were tested for CarMVby a two-step RT-PCR method, using PrimeScript RT-PCR kit (Takara, Japan) and the specific primers. No amplification was observed in the healthy control whereas a 1000 bp fragment corresponding to the CP gene of CarMV was amplified from a positive control. When the greenhouse samples were tested by RT-PCR, the 1000 bp fragment was amplified from 15 of 17 samples demonstrating that major carnation cultivars commonly grown in the most important carnation production region of Turkey were infected with CarMV. To confirm these results, an amplicon from the RT-PCR was sequenced and submitted to GenBank (Accession No. FJ825618). The sequence of the amplicon showed 99% nt identity with the CP gene of CarMV isolate ITALY-ca4 (EF622209).

The same samples were also tested for Carnation etch ring virus and Carnation ringspot virus, but none of the samples tested positive. Despite the small sample size, detection of CarMV in all the cultivars grown in the Antalya region indicated that CarMV has potential economical significance. Although typical mottling symptoms were not observed, growth retardation, narrowed leaves and small flowers resulting in reduced yield and quality of flowers that could be attributed to CarMV infection.To our knowledge, this is the first report of CarMV in Turkey.